Bio::PrimarySeq - Bioperl lightweight Sequence Object
# The Bio::SeqIO for file reading, Bio::DB::GenBank for # database reading use Bio::Seq; use Bio::SeqIO; use Bio::DB::GenBank; #make from memory $seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG', -id => 'GeneFragment-12', -accession_number => 'X78121', -moltype => 'dna' ); # read from file $inputstream = Bio::SeqIO->new(-file => "myseq.fa",-format => 'Fasta'); $seqobj = $inputstream->next_seq(); # get from database $db = Bio::DB::GenBank->new(); $seqobj = $db->get_Seq_by_acc('X78121'); # to get out parts of the sequence. print "Sequence ", $seqobj->id(), " with accession ", $seqobj->accession, " and desc ", $seqobj->desc, "\n"; $string = $seqobj->seq(); $string2 = $seqobj->subseq(1,40);
PrimarySeq is a lightweight Sequence object, storing little more than the sequence, its name, a computer useful unique name. It does not contain sequence features or other information. To have a sequence with sequence features you should use the Seq object which uses this object.
Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure Perl implementation of the interface (if that's gibberish to you, don't worry. The take home message is that this object is the bioperl default sequence object, but other people can use their own objects as sequences if they so wish). If you are interested in wrapping your own objects as compliant Bioperl sequence objects, then you should read the Bio::PrimarySeqI documentation
The documenation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI documentation. This allows all the methods which you can call on sequence objects here.
The Sequence object was completely rewritten for the 0.6 series. This was because the old Sequence object was becoming heavily bloated and difficult to maintain. There are some key changes from the old object to the new object, but basically, everything should work with the new object with a minimal number of changes.
The key change is that the format IO has been removed from this object and moved to the Bio::SeqIO system, which provides a much better way to encapsulate the sequence format reading. Please read the SeqIO documentation, but the take home message is that lines like
# old style reading from files $seq = Bio::Seq->new( -file => "myfile");
Becomes
# new style reading from files. $inputstream = Bio::SeqIO->new( -file => "myfile", -format => 'Fasta'); $seqobj = $inputstream->next_seq();
For writing files, a similar system is used
# old style writing to files print OUTPUT $seq->layout_fasta; # new style writing to files $outputstream = Bio::SeqIO->new( -fh => \*OUTPUT, -format => 'Fasta'); $outputstream->write_seq($seqobj);
A number of methods which were present in the old 0.04/0.05 series have been deprecated. Most of these methods work as before, but provide a warning that someone has called a deprecated method.
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion http://bio.perl.org/MailList.html - About the mailing lists
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via email or the web:
bioperl-bugs@bio.perl.org http://bio.perl.org/bioperl-bugs/
Email birney@sanger.ac.uk
Describe contact details here
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
Title : new Usage : $seq = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT', -id => 'human_id', -accession_number => 'AL000012', ); Function: Returns a new primary seq object from basic constructors, being a string for the sequence and strings for id and accession_number. Note that you can provide an empty sequence string. However, in this case you MUST specify the type of sequence you wish to initialize by the parameter -moltype. See moltype() for possible values. Returns : a new Bio::PrimarySeq object
Title : seq Usage : $string = $obj->seq() Function: Returns the sequence as a string of letters. The case of the letters is left up to the implementer. Suggested cases are upper case for proteins and lower case for DNA sequence (IUPAC standard), but you should not rely on this Returns : A scalar
Title : subseq Usage : $substring = $obj->subseq(10,40); Function: returns the subseq from start to end, where the first base is 1 and the number is inclusive, ie 1-2 are the first two bases of the sequence Returns : a string Args :
Title : length Usage : $len = $seq->length() Function: Example : Returns : integer representing the length of the sequence. Args :
Title : display_id Usage : $id_string = $obj->display_id(); Function: returns the display id, aka the common name of the Sequence object. The semantics of this is that it is the most likely string to be used as an identifier of the sequence, and likely to have "human" readability. The id is equivalent to the ID field of the GenBank/EMBL databanks and the id field of the Swissprot/sptrembl database. In fasta format, the >(\S+) is presumed to be the id, though some people overload the id to embed other information. Bioperl does not use any embedded information in the ID field, and people are encouraged to use other mechanisms (accession field for example, or extending the sequence object) to solve this. Returns : A string Args : None
Title : accession_number Usage : $unique_key = $obj->accession_number; Function: Returns the unique biological id for a sequence, commonly called the accession_number. For sequences from established databases, the implementors should try to use the correct accession number. Notice that primary_id() provides the unique id for the implemetation, allowing multiple objects to have the same accession number in a particular implementation. For sequences with no accession number, this method should return "unknown". Returns : A string Args : A string (optional) for setting
Title : primary_id Usage : $unique_key = $obj->primary_id; Function: Returns the unique id for this object in this implementation. This allows implementations to manage their own object ids in a way the implementaiton can control clients can expect one id to map to one object. For sequences with no natural primary id, this method should return a stringified memory location. Returns : A string Args : A string (optional, for setting)
Title : moltype Usage : if( $obj->moltype eq 'dna' ) { /Do Something/ } Function: Returns the type of sequence being one of 'dna', 'rna' or 'protein'. This is case sensitive. This is not called <type> because this would cause upgrade problems from the 0.5 and earlier Seq objects. Returns : a string either 'dna','rna','protein'. NB - the object must make a call of the type - if there is no type specified it has to guess. Args : none
Title : desc Usage : $obj->desc($newval) Function: Get/set description of the sequence. Example : Returns : value of desc Args : newvalue (optional)
Title : can_call_new Usage : Function: Example : Returns : Args :
Title : id Usage : $id = $seq->id() Function: This is mapped on display_id Example : Returns : Args :
These methods are available on Bio::PrimarySeq, although they are actually implemented on Bio::PrimarySeqI
Title : revcom Usage : $rev = $seq->revcom() Function: Produces a new Bio::SeqI implementing object which is the reversed complement of the sequence. For protein sequences this throws an exception of "Sequence is a protein. Cannot revcom" The id is the same id as the orginal sequence, and the accession number is also indentical. If someone wants to track that this sequence has be reversed, it needs to define its own extensions To do an inplace edit of an object you can go: $seqobj = $seqobj->revcom(); This of course, causes Perl to handle the garbage collection of the old object, but it is roughly speaking as efficient as an inplace edit. Returns : A new (fresh) Bio::SeqI object Args : none
Title : trunc Usage : $subseq = $myseq->trunc(10,100); Function: Provides a truncation of a sequence, Example : Returns : a fresh Bio::SeqI implementing object Args :
These are internal methods to PrimarySeq
Title : _guess_type Usage : Function: Example : Returns : Args :
To install Bio::Seq, copy and paste the appropriate command in to your terminal.
cpanm
cpanm Bio::Seq
CPAN shell
perl -MCPAN -e shell install Bio::Seq
For more information on module installation, please visit the detailed CPAN module installation guide.