Ewan Birney

NAME

Bio::Perl - Functional access to BioPerl for people who don't know objects

SYNOPSIS

   use Bio::Perl qw(read_sequence read_all_sequences write_sequence new_sequence get_sequence);

# will guess file format from extension $seq_object = read_sequence($filename);

# forces genbank format $seq_object = read_sequence($filename,'genbank');

# reads an array of sequences @seq_object_array = read_all_sequences($filename,'fasta');

# sequences are Bio::Seq objects, so the following methods work # for more info see Bio::Seq, or do 'perldoc Bio/Seq.pm'

   print "Sequence name is ",$seq_object->display_id,"\n";
   print "Sequence acc  is ",$seq_object->accession_number,"\n";
   print "First 5 bases is ",$seq_object->subseq(1,5),"\n";

# get the whole sequence as a single string

   $sequence_as_a_string = $seq_object->seq();

# writing sequences

   write_sequence(">$filename",'genbank',$seq_object);

   write_sequence(">$filename",'genbank',@seq_object_array);

# making a new sequence from just strings you have # from something else

   $seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA","myname","AL12232");

# getting a sequence from a database (assumes internet connection)

   $seq_object = get_sequence('swissprot',"ROA1_HUMAN");

   $seq_object = get_sequence('embl',"AI129902");

   $seq_object = get_sequence('genbank',"AI129902");

DESCRIPTION

Easy first time access to BioPerl via functions

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

  bioperl-l@bio.perl.org

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via email or the web:

  bioperl-bugs@bio.perl.org
  http://bio.perl.org/bioperl-bugs/

AUTHOR - Ewan Birney

Email bioperl-l@bio.perl.org

Describe contact details here

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

read_sequence

 Title   : read_sequence
 Usage   : $seq = read_sequence('sequences.fa')
           $seq = read_sequence($filename,'genbank');

           # pipes are fine
           $seq = read_sequence("my_fetching_program $id |",'fasta');

 Function: Reads the top sequence from the file. If no format is given, it will
           try to guess the format from the filename. If a format is given, it
           forces that format. The filename can be any valid perl open() string
           - in particular, you can put in pipes

 Returns : A Bio::Seq object. A quick synopsis:
           $seq_object->display_id - name of the sequence
           $seq_object->seq        - sequence as a string

 Args    : Two strings, first the filename - any Perl open() string is ok
           Second string is the format, which is optional

For more information on Seq objects see Bio::Seq.

read_all_sequences

 Title   : read_all_sequences
 Usage   : @seq_object_array = read_all_sequences($filename);
           @seq_object_array = read_all_sequences($filename,'genbank');

 Function: Just as the function above, but reads all the sequences in the
           file and loads them into an array.

           For very large files, you will run out of memory. When this
           happens, you've got to use the SeqIO system directly (this is
           not so hard! Don't worry about it!).

 Returns : array of Bio::Seq objects

 Args    : two strings, first the filename (any open() string is ok)
           second the format (which is optional)

See Bio::SeqIO and Bio::Seq for more information

write_sequence

 Title   : write_sequence
 Usage   : write_sequence(">new_file.gb",'genbank',$seq)
           write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)

 Function: writes sequences in the specified format

 Returns : true

 Args    : filename as a string, must provide an open() output file
           format as a string
           one or more sequence objects

new_sequence

 Title   : new_sequence
 Usage   :
 Function:
 Example :
 Returns : 
 Args    :

get_sequence

 Title   : get_sequence
 Usage   : $seq_object = get_sequence('swiss',"ROA1_HUMAN");

 Function: If the computer has Internet accessibility, gets
           the sequence from Internet accessible databases. Currently
           this supports Swissprot, EMBL, GenBank and RefSeq.

           Swissprot and EMBL are more robust than GenBank fetching.

           If the user is trying to retrieve a RefSeq entry from
           GenBank/EMBL, the query is silently redirected.

 Returns : A Bio::Seq object

 Args    : database type - one of swiss, embl, genbank or refseq
           identifier or accession number