Bio::Map::Microsatellite - An object representing a Microsatellite marker.
$o_usat = new Bio::Map::Microsatellite (-name=>'Chad Super Marker 2', -sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga', -motif => 'at', -repeats => 15, -repeat_start_position => 11 ); $sequence_before_usat = $o_usat->get_leading_flank(); $sequence_after_usat = $o_usat->get_trailing_flank();
This object handles the notion of an Microsatellite. This microsatellite can be placed on a (linear) Map or used on its own. If this Microsatellites will be used in a mapping context (it doesn't have to, you know) it can have multiple positions in a map. For information about a Microsatellite's position in a map one must query the associate PositionI object which is accessible through the position() method.
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the Bioperl mailing list. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion http://bioperl.org/MailList.shtml - About the mailing lists
Report bugs to the Bioperl bug tracking system to help us keep track of the bugs and their resolution. Bug reports can be submitted via email or the web:
bioperl-bugs@bioperl.org http://bugzilla.bioperl.org/
Email bioinformatics1@dieselwurks.com
Heikki Lehvaslaiho heikki@ebi.ac.uk Lincoln Stein lstein@cshl.org Jason Stajich jason@bioperl.org
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
Title : new Usage : $o_usat = Function: Builds a new Bio::Map::Microsatellite object Returns : Bio::Map::Microsatellite Args : -name => name of this microsatellite (optional, string, default 'Unknown microsatellite') -positions => position(s) for this marker in maps[optional], An array reference of tuples (array refs themselves) Each tuple conatins a Bio::Map::MapI-inherited object and a Bio::Map::PositionI-inherited obj, no default) -sequence => the sequence of this microsatellite (optional, scalar, no default) -motif => the repeat motif of this microsatellite (optional, scalar, no default) -repeats => the number of motif repeats for this microsatellite (optional, scalar, no default) -repeat_start_position => the starting position of the microsatellite in this sequence. The first base of the sequence is position "1". (optional, scalar, no default) Note : Creating a Bio::Map::Microsatellite object with no position might be useful for microsatellite people wanting to embrace and extend this module. <raising hand> Me! Me! Me! - using repeat_start_position will trigger a mechinism to calculate a value for repeat_end_position.
Title : position Usage : my $position = $mappable->position($map); OR $mappable->position($map,$position); OR Function: Get/Set the Bio::Map::PositionI for a mappable element in a specific Map Returns : Bio::Map::PositionI Args : $map =Bio::Map::MapI # Map we are talking about $position = Bio::Map::PositionI # Position we want to set
Title : name($new_name) Usage : $o_usat->name($new_name) _or_ my $name = $o_usat->name() Function: Get/Set the name for this Microsatellite Returns : A scalar representing the current name of this Microsatellite Args : If provided, the current name of this Microsatellite will be set to $new_name.
Title : motif($new_motif) Usage : my $motif = $o_usat->motif($new_motif) _or_ my $motif = $o_usat->motif() Function: Get/Set the repeat motif for this Microsatellite Returns : A scalar representing the current repeat motif of this Microsatellite. Args : If provided, the current repeat motif of this Microsatellite will be set to $new_motif.
Title : sequence($new_sequence) Usage : my $sequence = $o_usat->sequence($new_sequence) _or_ my $sequence = $o_usat->sequence() Function: Get/Set the sequence for this Microsatellite Returns : A scalar representing the current sequence of this Microsatellite. Args : If provided, the current sequence of this Microsatellite will be set to $new_sequence.
Title : repeats($new_repeats) Usage : my $repeats = $o_usat->repeats($new_repeats) _or_ my $repeats = $o_usat->repeats() Function: Get/Set the repeat repeats for this Microsatellite Returns : A scalar representing the current number of repeats of this Microsatellite. Args : If provided, the current number of repeats of this Microsatellite will be set to $new_repeats.
Title : repeat_start_position($new_repeat_start_position) Usage : my $repeat_start_position = $o_usat->repeat_start_position($new_repeat_start_position) _or_ my $repeat_start_position = $o_usat->repeat_start_position() Function: Get/Set the repeat repeat_start_position for this Microsatellite Returns : A scalar representing the repeat start position for this Microsatellite. Args : If provided, the current repeat start position of this Microsatellite will be set to $new_repeat_start_position. This method will also try to set the repeat end position. This depends on having information for the motif and the number of repeats. If you want to use methods like get_trailing_flank or get_leading flank, be careful to include the right information.
Title : repeat_end_position($set) Usage : $new_repeat_end_position = $o_usat->repeat_end_position("set"); _or_ $new_repeat_end_position = $o_usat->repeat_end_position($value); _or_ $current_repeat_end_position = $o_usat->repeat_end_position(); Function: get/set the end position of the repeat in this sequence Returns : A scalar representing the base index of the end of the repeat in this Microsatellite. The first base in the sequence is base 1. Args : A scalar representing a value, the string "set", or no argument (see Notes). Notes : If you do not provide an argument to this method, the current end position of the repeat in this Microsatellite will be returned (a scalar). If you provide the string "set" to this method it will set the end position based on the start position, the length of the motif, and the nuimber of repeats. If you specify a value the current end position of the repeat will be set to that value. This is a really bad idea. Don't do it.
Title : equals Usage : if( $mappable->equals($mapable2)) ... Function: Test if a position is equal to another position Returns : boolean Args : Bio::Map::MappableI
Title : less_than Usage : if( $mappable->less_than($m2) ) ... Function: Tests if a position is less than another position Returns : boolean Args : Bio::Map::MappableI
Title : greater_than Usage : if( $mappable->greater_than($m2) ) ... Function: Tests if position is greater than another position Returns : boolean Args : Bio::Map::MappableI
Title : get_leading_flank() Usage : $leading_sequence = $o_usat->get_leading_flank(); Returns : A scalar representing the sequence before the repeats in this Microsatellite. Args : None.
Title : get_trailing_flank() Usage : $trailing_flank = $o_usat->get_trailing_flank(); Returns : A scalar representing the sequence after the repeats in this Microsatellite. Args : None.
To install LocalConfig, copy and paste the appropriate command in to your terminal.
cpanm
cpanm LocalConfig
CPAN shell
perl -MCPAN -e shell install LocalConfig
For more information on module installation, please visit the detailed CPAN module installation guide.