The Perl Toolchain Summit needs more sponsors. If your company depends on Perl, please support this very important event.

NAME

Bio::PrimarySeq - Bioperl lightweight Sequence Object

SYNOPSIS

  # The Bio::SeqIO for file reading, Bio::DB::GenBank for
  # database reading

  use Bio::Seq;
  use Bio::SeqIO;
  use Bio::DB::GenBank;

  #make from memory
  $seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG',
                                   -id  => 'GeneFragment-12',
                                   -accession_number => 'X78121',
                                   -alphabet => 'dna',
                                   -is_circular => 1
                                   );
  print "Sequence ", $seqobj->id(), " with accession ", 
    $seqobj->accession_number, "\n";

  # read from file
  $inputstream = Bio::SeqIO->new(-file => "myseq.fa",-format => 'Fasta');
  $seqobj = $inputstream->next_seq();
  print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n";


  # to get out parts of the sequence.

  print "Sequence ", $seqobj->id(), " with accession ", 
    $seqobj->accession_number, " and desc ", $seqobj->desc, "\n";

  $string  = $seqobj->seq();
  $string2 = $seqobj->subseq(1,40);

DESCRIPTION

PrimarySeq is a lightweight Sequence object, storing little more than the sequence, its name, a computer useful unique name. It does not contain sequence features or other information. To have a sequence with sequence features you should use the Seq object which uses this object - go perldoc Bio::Seq

Although newusers will use Bio::PrimarySeq alot, in general you will be using it from the Bio::Seq object. For more information on Bio::Seq go perldoc Bio::Seq. For interest you might like to known that Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls to do with sequence to it (the has-a relationship lets us get out of a otherwise nasty cyclical reference in Perl which would leak memory).

Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure Perl implementation of the interface (if that's gibberish to you, don't worry. The take home message is that this object is the bioperl default sequence object, but other people can use their own objects as sequences if they so wish). If you are interested in wrapping your own objects as compliant Bioperl sequence objects, then you should read the Bio::PrimarySeqI documentation

The documenation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI documentation. This allows all the methods which you can call on sequence objects here.

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:

  http://bugzilla.open-bio.org/

AUTHOR - Ewan Birney

Email birney@sanger.ac.uk

Describe contact details here

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new

 Title   : new
 Usage   : $seq    = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT',
                                           -id  => 'human_id',
                                           -accession_number => 'AL000012',
                                           );

 Function: Returns a new primary seq object from
           basic constructors, being a string for the sequence
           and strings for id and accession_number.

           Note that you can provide an empty sequence string. However, in
           this case you MUST specify the type of sequence you wish to
           initialize by the parameter -alphabet. See alphabet() for possible
           values.
 Returns : a new Bio::PrimarySeq object
 Args    : -seq         => sequence string
           -display_id  => display id of the sequence (locus name) 
           -accession_number => accession number
           -primary_id  => primary id (Genbank id)
           -namespace   => the namespace for the accession
           -authority   => the authority for the namespace
           -desc        => description text
           -alphabet    => sequence type (alphabet) (dna|rna|protein)
           -id          => alias for display id
           -is_circular => boolean field for whether or not sequence is circular
 Throws  : Bio::Root::BadParameter if both -id and -display_id
           parameters are supplied and they are not the same.
           You only need to supply one of these parameters.
           -display_id is preferred and is synonymous with -id.

seq

 Title   : seq
 Usage   : $string    = $obj->seq()
 Function: Returns the sequence as a string of letters. The
           case of the letters is left up to the implementer.
           Suggested cases are upper case for proteins and lower case for
           DNA sequence (IUPAC standard), but you should not rely on this
 Returns : A scalar
 Args    : Optionally on set the new value (a string). An optional second
           argument presets the alphabet (otherwise it will be guessed).
           Both parameters may also be given in named paramater style
           with -seq and -alphabet being the names.

validate_seq

 Title   : validate_seq
 Usage   : if(! $seq->validate_seq($seq_str) ) {
                print "sequence $seq_str is not valid for an object of 
                alphabet ",$seq->alphabet, "\n";
           }
 Function: Validates a given sequence string. A validating sequence string
           must be accepted by seq(). A string that does not validate will
           lead to an exception if passed to seq().

           The implementation provided here does not take alphabet() into
           account. Allowed are all letters (A-Z) and '-','.', '*' and '?'.

 Example :
 Returns : 1 if the supplied sequence string is valid for the object, and
           0 otherwise.
 Args    : The sequence string to be validated.

subseq

 Title   : subseq
 Usage   : $substring = $obj->subseq(10,40);
 Function: returns the subseq from start to end, where the first base
           is 1 and the number is inclusive, ie 1-2 are the first two
           bases of the sequence
 Returns : a string
 Args    : integer for start position
           integer for end position
                 OR
           Bio::LocationI location for subseq (strand honored)

length

 Title   : length
 Usage   : $len = $seq->length();
 Function: Get the length of the sequence in number of symbols (bases
           or amino acids).

           You can also set this attribute, even to a number that does
           not match the length of the sequence string. This is useful
           if you don''t want to set the sequence too, or if you want
           to free up memory by unsetting the sequence. In the latter
           case you could do e.g.

               $seq->length($seq->length);
               $seq->seq(undef);

           Note that if you set the sequence to a value other than
           undef at any time, the length attribute will be
           invalidated, and the length of the sequence string will be
           reported again. Also, we won''t let you lie about the length.

 Example :
 Returns : integer representing the length of the sequence.
 Args    : Optionally, the value on set

display_id

 Title   : display_id or display_name
 Usage   : $id_string = $obj->display_id();
 Function: returns the display id, aka the common name of the Sequence object.

           The semantics of this is that it is the most likely string to
           be used as an identifier of the sequence, and likely to have
           "human" readability.  The id is equivalent to the ID field of
           the GenBank/EMBL databanks and the id field of the
           Swissprot/sptrembl database. In fasta format, the >(\S+) is
           presumed to be the id, though some people overload the id to
           embed other information. Bioperl does not use any embedded
           information in the ID field, and people are encouraged to use
           other mechanisms (accession field for example, or extending
           the sequence object) to solve this.

           With the new Bio::DescribeableI interface, display_name aliases
           to this method.

 Returns : A string
 Args    : None

accession_number

 Title   : accession_number or object_id
 Usage   : $unique_key = $obj->accession_number;
 Function: Returns the unique biological id for a sequence, commonly
           called the accession_number. For sequences from established
           databases, the implementors should try to use the correct
           accession number. Notice that primary_id() provides the
           unique id for the implemetation, allowing multiple objects
           to have the same accession number in a particular implementation.

           For sequences with no accession number, this method should
           return "unknown".

           [Note this method name is likely to change in 1.3]

           With the new Bio::IdentifiableI interface, this is aliased 
           to object_id

 Returns : A string
 Args    : A string (optional) for setting

primary_id

 Title   : primary_id
 Usage   : $unique_key = $obj->primary_id;
 Function: Returns the unique id for this object in this
           implementation. This allows implementations to manage their
           own object ids in a way the implementaiton can control
           clients can expect one id to map to one object.

           For sequences with no natural primary id, this method
           should return a stringified memory location.

 Returns : A string
 Args    : A string (optional, for setting)

alphabet

 Title   : alphabet
 Usage   : if( $obj->alphabet eq 'dna' ) { /Do Something/ }
 Function: Returns the alphabet of sequence, one of
           'dna', 'rna' or 'protein'. This is case sensitive.

           This is not called <type> because this would cause
           upgrade problems from the 0.5 and earlier Seq objects.

 Returns : a string either 'dna','rna','protein'. NB - the object must
           make a call of the type - if there is no alphabet specified it
           has to guess.
 Args    : (for setting) string of 'dna','rna', or 'protein'
 Throws  : Bio::Root::BadParameter if the supplied value
           is not a valid type. The offending value is placed within
           the -value field of the Error object.

desc

 Title   : desc or description
 Usage   : $obj->desc($newval)
 Function: Get/set description of the sequence.

           description is an alias for this for compliance with the
           Bio::DescribeableI interface.

 Example :
 Returns : value of desc (a string)
 Args    : newvalue (a string or undef, optional)

can_call_new

 Title   : can_call_new
 Usage   :
 Function:
 Example :
 Returns : true
 Args    :

id

 Title   : id
 Usage   : $id = $seq->id()
 Function: This is mapped on display_id
 Example :
 Returns :
 Args    :

Methods for Bio::IdentifiableI compliance

object_id

 Title   : object_id
 Usage   : $string    = $obj->object_id()
 Function: a string which represents the stable primary identifier
           in this namespace of this object. For DNA sequences this
           is its accession_number, similarly for protein sequences

           This is aliased to accession_number().
 Returns : A scalar

version

 Title   : version
 Usage   : $version    = $obj->version()
 Function: a number which differentiates between versions of
           the same object. Higher numbers are considered to be
           later and more relevant, but a single object described
           the same identifier should represent the same concept

 Returns : A number

authority

 Title   : authority
 Usage   : $authority    = $obj->authority()
 Function: a string which represents the organisation which
           granted the namespace, written as the DNS name for  
           organisation (eg, wormbase.org)

 Returns : A scalar

namespace

 Title   : namespace
 Usage   : $string    = $obj->namespace()
 Function: A string representing the name space this identifier
           is valid in, often the database name or the name
           describing the collection 

 Returns : A scalar

Methods for Bio::DescribableI compliance

This comprises of display_name and description.

display_name

 Title   : display_name
 Usage   : $string    = $obj->display_name()
 Function: A string which is what should be displayed to the user
           the string should have no spaces (ideally, though a cautious
           user of this interface would not assumme this) and should be
           less than thirty characters (though again, double checking 
           this is a good idea)

           This is aliased to display_id().
 Returns : A scalar

description

 Title   : description
 Usage   : $string    = $obj->description()
 Function: A text string suitable for displaying to the user a 
           description. This string is likely to have spaces, but
           should not have any newlines or formatting - just plain
           text. The string should not be greater than 255 characters
           and clients can feel justified at truncating strings at 255
           characters for the purposes of display

           This is aliased to desc().
 Returns : A scalar

Methods Inherited from Bio::PrimarySeqI

These methods are available on Bio::PrimarySeq, although they are actually implemented on Bio::PrimarySeqI

revcom

 Title   : revcom
 Usage   : $rev = $seq->revcom()
 Function: Produces a new Bio::SeqI implementing object which
           is the reversed complement of the sequence. For protein
           sequences this throws an exception of
           "Sequence is a protein. Cannot revcom"

           The id is the same id as the orginal sequence, and the
           accession number is also indentical. If someone wants to
           track that this sequence has be reversed, it needs to
           define its own extensions

           To do an inplace edit of an object you can go:

           $seqobj = $seqobj->revcom();

           This of course, causes Perl to handle the garbage
           collection of the old object, but it is roughly speaking as
           efficient as an inplace edit.

 Returns : A new (fresh) Bio::SeqI object
 Args    : none

trunc

 Title   : trunc
 Usage   : $subseq = $myseq->trunc(10,100);
 Function: Provides a truncation of a sequence,

 Example :
 Returns : a fresh Bio::SeqI implementing object
 Args    :

Internal methods

These are internal methods to PrimarySeq

_guess_alphabet

 Title   : _guess_alphabet
 Usage   :
 Function:
 Example :
 Returns :
 Args    :
 Throws  : Bio::Root::BadParameter if the string obtained from 
           PrimarySeq::seq() is empty.