Bio::Grep::Benchmarks - Bio::Grep Benchmarks
A collection of quick and dirty benchmarks.
4 x Intel(R) Core(TM)2 Quad CPU Q9400 @ 2.66GHz, 4GB RAM. Fedora Linux 2.6.27.38-170.2.113.fc10.i686.PAE (kernel: 2.6.27.38-170.2.113.fc10.i686.PAE). Perl 5.10.0.0.
TAIR8_cdna_20080412 (Arabidopsis CDNA Fasta file, 63MB).
Bio::Grep 0.10.6.
Average over 2 iterations.
GUUGle : 2.88 sec Agrep/RE : 10.69 sec Vmatch (-pl 3) : 135.32 sec
Query: ugacagaagagagugagcac (revcom)
ugacagaagagagugagcac
Average over 20 iterations.
Vmatch : 0.02 sec Agrep (Wu-Manber): 0.22 sec RE : 1.66 sec Vmatch (-online) : 3.80 sec GUUGle : 6.18 sec Agrep (TRE) : 10.22 sec
Note that Vmatch needs one slow run to load the suffix arrays in memory (Values are the average over 20 iterations). Also note that GUUGle allows GU mismatches.
Vmatch
Vmatch : 0.05 sec Agrep (Wu-Manber): 0.98 sec Vmatch (-online) : 3.85 sec Agrep (TRE) : 35.26 sec GUUGle : n/a RE : n/a
Vmatch : 0.12 sec Agrep (Wu-Manber): 1.28 sec Vmatch (-online) : 3.89 sec Agrep (TRE) : 43.48 sec GUUGle : n/a RE : n/a
Vmatch : 0.28 sec Agrep (Wu-Manber): 1.57 sec Vmatch (-online) : 4.01 sec Agrep (TRE) : 50.66 sec GUUGle : n/a RE : n/a
Vmatch : 0.93 sec Agrep (Wu-Manber): 1.89 sec Vmatch (-online) : 4.48 sec Agrep (TRE) : 57.43 sec GUUGle : n/a RE : n/a
Agrep (Wu-Manber): 2.42 sec Vmatch : 3.95 sec Vmatch (-online) : 6.85 sec Agrep (TRE) : 64.81 sec GUUGle : n/a RE : n/a
The script that generated these benchmarks is available in the examples directory of this distribution.
Please report any bugs, feature requests and benchmarks to bug-bio-grep@rt.cpan.org, or through the web interface at http://rt.cpan.org.
bug-bio-grep@rt.cpan.org
Markus Riester, <mriester@gmx.de>
Copyright (C) 2007-2009 M. Riester.
This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.
To install Bio::Grep, copy and paste the appropriate command in to your terminal.
cpanm
cpanm Bio::Grep
CPAN shell
perl -MCPAN -e shell install Bio::Grep
For more information on module installation, please visit the detailed CPAN module installation guide.