Bio::PrimarySeq - Bioperl lightweight Sequence Object
# Bio::SeqIO for file reading, Bio::DB::GenBank for # database reading use Bio::Seq; use Bio::SeqIO; use Bio::DB::GenBank; # make from memory $seqobj = Bio::PrimarySeq->new ( -seq => 'ATGGGGTGGGCGGTGGGTGGTTTG', -id => 'GeneFragment-12', -accession_number => 'X78121', -alphabet => 'dna', -is_circular => 1 ); print "Sequence ", $seqobj->id(), " with accession ", $seqobj->accession_number, "\n"; # read from file $inputstream = Bio::SeqIO->new(-file => "myseq.fa", -format => 'Fasta'); $seqobj = $inputstream->next_seq(); print "Sequence ", $seqobj->id(), " and desc ", $seqobj->desc, "\n"; # to get out parts of the sequence. print "Sequence ", $seqobj->id(), " with accession ", $seqobj->accession_number, " and desc ", $seqobj->desc, "\n"; $string = $seqobj->seq(); $string2 = $seqobj->subseq(1,40);
PrimarySeq is a lightweight Sequence object, storing the sequence, its name, a computer-useful unique name, and other fundamental attributes. It does not contain sequence features or other information. To have a sequence with sequence features you should use the Seq object which uses this object.
Although new users will use Bio::PrimarySeq a lot, in general you will be using it from the Bio::Seq object. For more information on Bio::Seq see Bio::Seq. For interest you might like to know that Bio::Seq has-a Bio::PrimarySeq and forwards most of the function calls to do with sequence to it (the has-a relationship lets us get out of a otherwise nasty cyclical reference in Perl which would leak memory).
Sequence objects are defined by the Bio::PrimarySeqI interface, and this object is a pure Perl implementation of the interface. If that's gibberish to you, don't worry. The take home message is that this object is the bioperl default sequence object, but other people can use their own objects as sequences if they so wish. If you are interested in wrapping your own objects as compliant Bioperl sequence objects, then you should read the Bio::PrimarySeqI documentation
The documentation of this object is a merge of the Bio::PrimarySeq and Bio::PrimarySeqI documentation. This allows all the methods which you can call on sequence objects here.
User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
bioperl-l@bioperl.org - General discussion http://bioperl.org/wiki/Mailing_lists - About the mailing lists
Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:
http://bugzilla.open-bio.org/
Email birney@ebi.ac.uk
The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _
Title : new Usage : $seq = Bio::PrimarySeq->new( -seq => 'ATGGGGGTGGTGGTACCCT', -id => 'human_id', -accession_number => 'AL000012', ); Function: Returns a new primary seq object from basic constructors, being a string for the sequence and strings for id and accession_number. Note that you can provide an empty sequence string. However, in this case you MUST specify the type of sequence you wish to initialize by the parameter -alphabet. See alphabet() for possible values. Returns : a new Bio::PrimarySeq object Args : -seq => sequence string -display_id => display id of the sequence (locus name) -accession_number => accession number -primary_id => primary id (Genbank id) -namespace => the namespace for the accession -authority => the authority for the namespace -description => description text -desc => alias for description -alphabet => sequence type (alphabet) (dna|rna|protein) -id => alias for display id -is_circular => boolean field for whether or not sequence is circular
Title : seq Usage : $string = $obj->seq() Function: Returns the sequence as a string of letters. The case of the letters is left up to the implementer. Suggested cases are upper case for proteins and lower case for DNA sequence (IUPAC standard), but you should not rely on this. Returns : A scalar Args : Optionally on set the new value (a string). An optional second argument presets the alphabet (otherwise it will be guessed).
Title : validate_seq Usage : if(! $seq->validate_seq($seq_str) ) { print "sequence $seq_str is not valid for an object of alphabet ",$seq->alphabet, "\n"; } Function: Validates a given sequence string. A validating sequence string must be accepted by seq(). A string that does not validate will lead to an exception if passed to seq(). The implementation provided here does not take alphabet() into account. Allowed are all letters (A-Z) and '-','.','*','?','=', and '~'. Example : Returns : 1 if the supplied sequence string is valid for the object, and 0 otherwise. Args : The sequence string to be validated.
Title : subseq Usage : $substring = $obj->subseq(10,40); Function: returns the subseq from start to end, where the first base is 1 and the number is inclusive, ie 1-2 are the first two bases of the sequence Returns : a string Args : integer for start position integer for end position OR Bio::LocationI location for subseq (strand honored)
Title : length Usage : $len = $seq->length(); Function: Get the length of the sequence in number of symbols (bases or amino acids). You can also set this attribute, even to a number that does not match the length of the sequence string. This is useful if you don''t want to set the sequence too, or if you want to free up memory by unsetting the sequence. In the latter case you could do e.g. $seq->length($seq->length); $seq->seq(undef); Note that if you set the sequence to a value other than undef at any time, the length attribute will be invalidated, and the length of the sequence string will be reported again. Also, we won''t let you lie about the length. Example : Returns : integer representing the length of the sequence. Args : Optionally, the value on set
Title : display_id or display_name Usage : $id_string = $obj->display_id(); Function: returns the display id, aka the common name of the Sequence object. The semantics of this is that it is the most likely string to be used as an identifier of the sequence, and likely to have "human" readability. The id is equivalent to the ID field of the GenBank/EMBL databanks and the id field of the Swissprot/sptrembl database. In fasta format, the >(\S+) is presumed to be the id, though some people overload the id to embed other information. Bioperl does not use any embedded information in the ID field, and people are encouraged to use other mechanisms (accession field for example, or extending the sequence object) to solve this. With the new Bio::DescribeableI interface, display_name aliases to this method. Returns : A string Args : None
Title : accession_number or object_id Usage : $unique_key = $obj->accession_number; Function: Returns the unique biological id for a sequence, commonly called the accession_number. For sequences from established databases, the implementors should try to use the correct accession number. Notice that primary_id() provides the unique id for the implemetation, allowing multiple objects to have the same accession number in a particular implementation. For sequences with no accession number, this method should return "unknown". [Note this method name is likely to change in 1.3] With the new Bio::IdentifiableI interface, this is aliased to object_id Returns : A string Args : A string (optional) for setting
Title : primary_id Usage : $unique_key = $obj->primary_id; Function: Returns the unique id for this object in this implementation. This allows implementations to manage their own object ids in a way the implementaiton can control clients can expect one id to map to one object. For sequences with no natural primary id, this method should return a stringified memory location. Returns : A string Args : A string (optional, for setting)
Title : alphabet Usage : if( $obj->alphabet eq 'dna' ) { /Do Something/ } Function: Get/Set the alphabet of sequence, one of 'dna', 'rna' or 'protein'. This is case sensitive. This is not called <type> because this would cause upgrade problems from the 0.5 and earlier Seq objects. Returns : a string either 'dna','rna','protein'. NB - the object must make a call of the type - if there is no alphabet specified it has to guess. Args : optional string to set : 'dna' | 'rna' | 'protein'
Title : desc or description Usage : $obj->desc($newval) Function: Get/set description of the sequence. 'description' is an alias for this for compliance with the Bio::DescribeableI interface. Example : Returns : value of desc (a string) Args : newvalue (a string or undef, optional)
Title : can_call_new Usage : Function: Example : Returns : true Args :
Title : id Usage : $id = $seq->id() Function: This is mapped on display_id Example : Returns : Args :
Title : is_circular Usage : if( $obj->is_circular) { /Do Something/ } Function: Returns true if the molecule is circular Returns : Boolean value Args : none
Title : object_id Usage : $string = $obj->object_id() Function: A string which represents the stable primary identifier in this namespace of this object. For DNA sequences this is its accession_number, similarly for protein sequences. This is aliased to accession_number(). Returns : A scalar
Title : version Usage : $version = $obj->version() Function: A number which differentiates between versions of the same object. Higher numbers are considered to be later and more relevant, but a single object described the same identifier should represent the same concept. Returns : A number
Title : authority Usage : $authority = $obj->authority() Function: A string which represents the organisation which granted the namespace, written as the DNS name for organisation (eg, wormbase.org). Returns : A scalar
Title : namespace Usage : $string = $obj->namespace() Function: A string representing the name space this identifier is valid in, often the database name or the name describing the collection. Returns : A scalar
This comprises of display_name and description.
Title : display_name Usage : $string = $obj->display_name() Function: A string which is what should be displayed to the user. The string should have no spaces (ideally, though a cautious user of this interface would not assumme this) and should be less than thirty characters (though again, double checking this is a good idea). This is aliased to display_id(). Returns : A scalar
Title : description Usage : $string = $obj->description() Function: A text string suitable for displaying to the user a description. This string is likely to have spaces, but should not have any newlines or formatting - just plain text. The string should not be greater than 255 characters and clients can feel justified at truncating strings at 255 characters for the purposes of display. This is aliased to desc(). Returns : A scalar
These methods are available on Bio::PrimarySeq, although they are actually implemented on Bio::PrimarySeqI
Title : revcom Usage : $rev = $seq->revcom() Function: Produces a new Bio::SeqI implementing object which is the reversed complement of the sequence. For protein sequences this throws an exception of "Sequence is a protein. Cannot revcom". The id is the same id as the orginal sequence, and the accession number is also indentical. If someone wants to track that this sequence has be reversed, it needs to define its own extensions. To do an inplace edit of an object you can go: $seqobj = $seqobj->revcom(); This of course, causes Perl to handle the garbage collection of the old object, but it is roughly speaking as efficient as an inplace edit. Returns : A new (fresh) Bio::SeqI object Args : none
Title : trunc Usage : $subseq = $myseq->trunc(10,100); Function: Provides a truncation of a sequence, Example : Returns : A fresh Bio::SeqI implementing object. Args :
These are internal methods to PrimarySeq
Title : _guess_alphabet Usage : Function: Determines (and sets) the type of sequence: dna, rna, protein Example : Returns : one of strings 'dna', 'rna' or 'protein'. Args : none
To install Bio::Seq, copy and paste the appropriate command in to your terminal.
cpanm
cpanm Bio::Seq
CPAN shell
perl -MCPAN -e shell install Bio::Seq
For more information on module installation, please visit the detailed CPAN module installation guide.