fu-hash - Print sequence hashes
version 1.5.0
fu-hash [options] [FILE1 FILE2 FILE3...]
fu-hash - hash sequences (dereplicate and rename)
A multifasta file with MD5 hash and size of each sequence like
>6310f1f8992a4d08dc4e601e66e28286;size=2 ACAGCGTACGTGATCGACGTAGCTAGCTGACGAGCTAGCTACACACGATCGTAGCTGGTAGTCAGTCGAT CGACGTAGCTAGCAACAGCGTACGTGATCGACGTAGCTAGCTGACGAGCTAGCTACACACGATCGTAGCTGG TAGTCAGTCGATCGACGTAGCTAGCA
Andrea Telatin <andrea@telatin.com>
This software is Copyright (c) 2018-2022 by Andrea Telatin.
This is free software, licensed under:
The MIT (X11) License
To install Proch::N50, copy and paste the appropriate command in to your terminal.
cpanm
cpanm Proch::N50
CPAN shell
perl -MCPAN -e shell install Proch::N50
For more information on module installation, please visit the detailed CPAN module installation guide.