—
—
—
—
—
—
—
—
—
—
—
—

              
# BioPerl module for Bio::Map::Microsatellite
#
# Cared for by Sendu Bala <bix@sendu.me.uk>
#
# Copyright Chad Matsalla
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
HideShow 64 lines of Pod
=head1 NAME
Bio::Map::Microsatellite - An object representing a Microsatellite marker.
=head1 SYNOPSIS
  $o_usat = new Bio::Map::Microsatellite
      (-name=>'Chad Super Marker 2',
       -sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
       -motif => 'at',
       -repeats => 15,
       -repeat_start_position => 11
       );
  $sequence_before_usat = $o_usat->get_leading_flank();
  $sequence_after_usat = $o_usat->get_trailing_flank();
=head1 DESCRIPTION
This object handles the notion of an Microsatellite. This microsatellite can
be placed on a (linear) Map or used on its own.  If this Microsatellites
will be used in a mapping context (it doesn't have to, you know) it can have
multiple positions in a map. For information about a Microsatellite's position
in a map one must query the associate PositionI object which is accessible
through the position() method.
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list.  Your participation is much appreciated.
  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via the
web:
  http://bugzilla.open-bio.org/
=head1 AUTHOR - Chad Matsalla
Email bioinformatics1@dieselwurks.com
=head1 CONTRIBUTORS
Heikki Lehvaslaiho heikki-at-bioperl-dot-org
Lincoln Stein      lstein@cshl.org
Jason Stajich      jason@bioperl.org
Sendu Bala         bix@sendu.me.uk
=head1 APPENDIX
The rest of the documentation details each of the object methods.
Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::Map::Microsatellite;
use strict;
use base qw(Bio::Map::Marker);
HideShow 32 lines of Pod
=head2 new
 Title   : new
 Usage   : $o_usat = 
 Function: Builds a new Bio::Map::Microsatellite object
 Returns : Bio::Map::Microsatellite
 Args    :
        -name    => name of this microsatellite (optional, string,
                default 'Unknown microsatellite')
        -positions => position(s) for this marker in maps[optional],
                An array reference of tuples (array refs themselves)
                Each tuple conatins a Bio::Map::MapI-inherited object and a 
                Bio::Map::PositionI-inherited obj, no default)
        -sequence => the sequence of this microsatellite (optional,
                 scalar, no default)
        -motif => the repeat motif of this microsatellite (optional,
                 scalar, no default)
        -repeats => the number of motif repeats for this microsatellite
                (optional, scalar, no default)
        -repeat_start_position => the starting position of the
                microsatellite in this sequence. The first base of the
                sequence is position "1". (optional, scalar, no default)
 Note    : Creating a Bio::Map::Microsatellite object with no position
        might be useful for microsatellite people wanting to embrace
        and extend this module. <raising hand> Me! Me! Me!
        - using repeat_start_position will trigger a mechinism to
        calculate a value for repeat_end_position. 
=cut
sub new {
    my ($class,@args) = @_;
    my $self = $class->SUPER::new(@args);
    my ($map, $position, $sequence, $motif, $repeats, $start) = 
        $self->_rearrange([qw(MAP
                              POSITION
                              SEQUENCE 
                              MOTIF 
                              REPEATS 
                              REPEAT_START_POSITION
                              )], @args);
    if( ! $self->name ) { 
        $self->name('Unnamed microsatellite');
    }
    $map && $self->map($map);
    $position && $self->position($position);
    $sequence && $self->sequence($sequence);
    $self->motif(defined $motif ? $motif : 'Unknown motif'); 
    $repeats && $self->repeats($repeats);
    $start && $self->repeat_start_position($start);
    return $self;
}
HideShow 12 lines of Pod
=head2 motif
 Title   : motif
 Usage   : $o_usat->motif($new_motif);
               my $motif = $o_usat->motif();
 Function: Get/Set the repeat motif for this Microsatellite.
 Returns : A scalar representing the current repeat motif of this
               Microsatellite.
 Args    : none to get, OR string to set
=cut
sub motif {
        my ($self,$motif) = @_;
        if ($motif) {
                $self->{'_motif'} = $motif;
        }
        return $self->{'_motif'};    
}
HideShow 12 lines of Pod
=head2 sequence
 Title   : sequence
 Usage   : $o_usat->sequence($new_sequence);
               my $sequence = $o_usat->sequence();
 Function: Get/Set the sequence for this Microsatellite.
 Returns : A scalar representing the current sequence of this
               Microsatellite.
 Args    : none to get, OR string to set
=cut
sub sequence {
        my ($self,$sequence) = @_;
        if ($sequence) {
                $self->{'_sequence'} = $sequence;
        }
        return $self->{'_sequence'}; 
}
HideShow 12 lines of Pod
=head2 repeats
 Title   : repeats
 Usage   : $o_usat->repeats($new_repeats);
               my $repeats = $o_usat->repeats()
 Function: Get/Set the repeat repeats for this Microsatellite.
 Returns : A scalar representing the current number of repeats of this
               Microsatellite.
 Args    : none to get, OR int to set
=cut
sub repeats {
        my ($self,$repeats) = @_;
        if ($repeats) {
                $self->{'_repeats'} = $repeats;
        }
        return $self->{'_repeats'};  
}
HideShow 17 lines of Pod
=head2 repeat_start_position
 Title   : repeat_start_position
 Usage   : $o_usat->repeat_start_position($new_repeat_start_position);
               my $repeat_start_position = $o_usat->repeat_start_position();
 Function: Get/Set the repeat repeat_start_position for this
               Microsatellite
 Returns : A scalar representing the repeat start position for this 
               Microsatellite.
 Args    : none to get, OR string to set
               This method will also try to set the repeat end position. This
               depends on having information for the motif and the number of
               repeats. If you want to use methods like get_trailing_flank or
               get_leading flank, be careful to include the right information.
=cut
sub repeat_start_position {
        my ($self,$repeat_start_position) = @_;
        if ($repeat_start_position) {
                $self->{'_repeat_start_position'} = $repeat_start_position;
                $self->repeat_end_position("set");
        }
        return $self->{'_repeat_start_position'};    
}
HideShow 24 lines of Pod
=head2 repeat_end_position
 Title   : repeat_end_position
 Usage   : $o_usat->repeat_end_position("set");
               $o_usat->repeat_end_position($value);
               $current_repeat_end_position = $o_usat->repeat_end_position();
 Function: Get/set the end position of the repeat in this sequence.
 Returns : A scalar representing the base index of the end of the
               repeat in this Microsatellite. The first base in the sequence
               is base 1.
 Args    : A scalar representing a value, the string "set", or no
               argument (see Notes).
 Notes   : If you do not provide an argument to this method, the current
           end position of the repeat in this Microsatellite will be
           returned (a scalar).
           If you provide the string "set" to this method it will set the
           end position based on the start position, the length of the
           motif, and the number of repeats.
           If you specify a value the current end position of the repeat
           will be set to that value. This is a really bad idea. Don't do
           it.
=cut
sub repeat_end_position {
    my ($self,$caller) = @_;
    if( defined $caller ) { 
        if ($caller eq "set") {
            $self->{'_repeat_end_position'} = 
                $self->{'_repeat_start_position'} + 
                    (length($self->motif()) * $self->repeats());
        }
        elsif ($caller) {
            $self->{'_repeat_end_position'} = $caller;
        }
    }
    return $self->{'_repeat_end_position'};
}
HideShow 10 lines of Pod
=head2 equals
 Title   : equals
 Usage   : if ($mappable->equals($mapable2)) {...}
 Function: Test if a position is equal to another position
 Returns : boolean
 Args    : Bio::Map::MappableI
=cut
sub equals {
        my ($self,@args) = @_;
        $self->throw_not_implemented();
}
HideShow 10 lines of Pod
=head2 less_than
 Title   : less_than
 Usage   : if ($mappable->less_than($m2)) {...}
 Function: Tests if a position is less than another position
 Returns : boolean
 Args    : Bio::Map::MappableI
=cut
sub less_than {
        my ($self,@args) = @_;
        $self->throw_not_implemented();
}
HideShow 10 lines of Pod
=head2 greater_than
 Title   : greater_than
 Usage   : if ($mappable->greater_than($m2)) {...}
 Function: Tests if position is greater than another position
 Returns : boolean
 Args    : Bio::Map::MappableI
=cut
sub greater_than {
        my ($self,@args) = @_;
        $self->throw_not_implemented();
}
HideShow 10 lines of Pod
=head2 get_leading_flank
 Title   : get_leading_flank
 Usage   : $leading_sequence = $o_usat->get_leading_flank();
 Returns : A scalar representing the sequence before the repeats in this
               Microsatellite.
 Args    : none
=cut
sub get_leading_flank {
        my $self = shift;
        return substr $self->sequence(),0,$self->repeat_start_position-1;
}
HideShow 10 lines of Pod
=head2 get_trailing_flank
 Title   : get_trailing_flank
 Usage   : $trailing_flank = $o_usat->get_trailing_flank();
 Returns : A scalar representing the sequence after the repeats in this
               Microsatellite.
 Args    : none
=cut
sub get_trailing_flank {
        my $self = shift;
        return substr $self->sequence(),$self->repeat_end_position()-1;
}
1;