—
—
—
—
—
—
—
—
—
—
—

              
# $Id: Primer.pm,v 1.21.4.1 2006/10/02 23:10:28 sendu Exp $
#
# BioPerl module for Bio::SeqFeature::Primer
#
# This is the original copyright statement. I have relied on Chad's module
# extensively for this module.
#
# Copyright (c) 1997-2001 bioperl, Chad Matsalla. All Rights Reserved.
#           This module is free software; you can redistribute it and/or
#           modify it under the same terms as Perl itself. 
#
# Copyright Chad Matsalla
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
#
# But I have modified lots of it, so I guess I should add:
#
# Copyright (c) 2003 bioperl, Rob Edwards. All Rights Reserved.
#           This module is free software; you can redistribute it and/or
#           modify it under the same terms as Perl itself. 
#
# Copyright Rob Edwards
#
# You may distribute this module under the same terms as perl itself
# POD documentation - main docs before the code
HideShow 96 lines of Pod
=head1 NAME
Bio::SeqFeature::Primer - Primer Generic SeqFeature
=head1 SYNOPSIS
 # set up a single primer that can be used in a PCR reaction
 use Bio::SeqFeature::Primer;
 # initiate a primer with raw sequence
 my $primer=Bio::SeqFeature::Primer->new(-seq=>'CTTTTCATTCTGACTGCAACG');
 # get the primery tag for the primer # should return Primer
 my $tag=$primer->primary_tag;
 # get or set the location that the primer binds to the target at
 $primer->location(500);
 my $location=$primer->location(500);
 # get or set the 5' end of the primer homology, as the primer doesn't 
 # have to be the same as the target sequence
 $primer->start(2);
 my $start=$primer->start;
 # get or set the 3' end of the primer homology
 $primer->end(19);
 my $end = $primer->end;
 # get or set the strand of the primer. Strand should be 1, 0, or -1
 $primer->strand(-1);
 my $strand=$primer->strand;
 # get or set the id of the primer
 $primer->display_id('test_id');
 my $id=$primer->display_id;
 # get the tm of the primer. This is calculated for you by the software.
 # however, see the docs.
 my $tm = $primer->Tm;
 print "These are the details of the primer:\n\tTag:\t\t$tag\n\tLocation\t$location\n\tStart:\t\t$start\n";
 print "\tEnd:\t\t$end\n\tStrand:\t\t$strand\n\tID:\t\t$id\n\tTm:\t\t$tm\n";
=head1 DESCRIPTION
Handle primer sequences. This will allow you to generate a primer
object required for a Bio::Seq::PrimedSeq object. This module is
designed to integrate with Bio::Tools::Primer3 and
Bio::Seq::PrimedSeq.
In addition, you can calculate the melting temperature of the primer.
This module is supposed to implement location and range, presumably
through generic.pm, but does not do so yet. However, it does allow you
to set primers, and use those objects as the basis for
Bio::Seq::PrimedSeq objects.
See also the POD for Bio::Seq::PrimedSeq and
Bio::Tools::Nucleotide::Analysis::Primer3
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to one
of the Bioperl mailing lists.  Your participation is much appreciated.
  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
the bugs and their resolution.  Bug reports can be submitted via the
web:
  http://bugzilla.open-bio.org/
=head1 AUTHOR 
Rob Edwards, redwards@utmem.edu
The original concept and much of the code was written by
Chad Matsalla, bioinformatics1@dieselwurks.com
=head1 APPENDIX
        The rest of the documentation details each of the object
        methods. Internal methods are usually preceded with a _
=cut
# Let the code begin...
package Bio::SeqFeature::Primer;
use strict;
use Bio::Seq;
use Bio::Tools::SeqStats;
use vars qw ($AUTOLOAD @RES %OK_FIELD $ID);
BEGIN {
 @RES=qw(); # nothing here yet, not sure what we want!
 foreach my $attr (@RES) {$OK_FIELD{$attr}++}
}
use base qw(Bio::Root::Root Bio::SeqFeature::Generic);
$ID = 'Bio::SeqFeature::Primer';
sub AUTOLOAD {
 my $self = shift;
 my $attr = $AUTOLOAD;
 $attr =~ s/.*:://;
 $self->throw("Unallowed parameter: $attr !") unless $OK_FIELD{$attr};
 $self->{$attr} = shift if @_;
 return $self->{$attr};
}
HideShow 10 lines of Pod
=head2 new()
 Title   : new()
 Usage   : $primer = Bio::SeqFeature::Primer(-seq=>sequence_object);
 Function: Instantiate a new object
 Returns : A SeqPrimer object
 Args    : You must pass either a sequence object (preferable) or a sequence. 
=cut
sub new {
  # I have changed some of Chad's code. I hope he doesn't mind. Mine is more stupid than his, but my simple mind gets it.
  # I also removed from of the generic.pm things, but we can put them back....
  my ($class, %args) = @_;  
  my $self = $class->SUPER::new(%args);
  # i am going to keep an array of the things that have been passed
  # into the object on construction. this will aid retrieval of these
  # things later
  foreach my $argument (keys %args) {
   if ($argument eq "-SEQUENCE" || $argument eq "-sequence" || $argument eq "-seq") {
    if (ref($args{$argument}) eq "Bio::Seq") {$self->{seq} = $args{$argument}}
    else {
     unless ($args{-id}) {$args{-id}="SeqFeature Primer object"}
     $self->{seq} = new Bio::Seq( -seq => $args{$argument}, -id => $args{-id});
    }
    $self->{$argument} = $self->{seq};
    push (@{$self->{arguments}}, "seq");
   }
   else {
    $self->{$argument} = $args{$argument};
    push (@{$self->{arguments}}, $argument); # note need to check the BioPerl way of doing this.
   }
  }
  # now error check and make sure that we at least got a sequence
  if (!$self->{seq}) {$self->throw("You must pass in a sequence to construct this object.")}
   # a bunch of things now need to be set for this SeqFeature
   # things like:
   # TARGET=513,26
   # PRIMER_FIRST_BASE_INDEX=1
   # PRIMER_LEFT=484,20
   # these can be added in, and we won't demand them, but provide a mechanism to check that they exist
   $self->Tm();
   return $self;
}
HideShow 10 lines of Pod
=head2 seq()
 Title   : seq()
 Usage   : $seq = $primer->seq();
 Function: Return the sequence associated with this Primer. 
 Returns : A Bio::Seq object
 Args    : None.
=cut
sub seq {
     my $self = shift;
     return $self->{seq};
}
sub primary_tag {
     return "Primer";
}
HideShow 11 lines of Pod
=head2 source_tag()
 Title   : source_tag()
 Usage   : $tag = $feature->source_tag();
 Function: Returns the source of this tag.
 Returns : A string.
 Args    : If an argument is provided, the source of this SeqFeature
           is set to that argument.
=cut
sub source_tag {
     my ($self,$insource) = @_;
     if ($insource) { $self->{source} = $insource; }
     return $self->{source};
}
HideShow 17 lines of Pod
=head2 location()
 Title   : location()
 Usage   : $tag = $primer->location();
 Function: Gets or sets the location of the primer on the sequence  
 Returns : If the location is set, returns that, if not returns 0. 
           Note: At the moment I am using the primer3 notation of location
           (although you can set whatever you want). 
           In this form, both primers are given from their 5' ends and a length.
           In this case, the left primer is given from the leftmost end, but
           the right primer is given from the rightmost end.
           You can use start() and end() to get the leftmost and rightmost base
           of each sequence.
 Args    : If supplied will set a location
=cut
sub location {
     my ($self, $location) = @_;
     if ($location) {$self->{location}=$location}
     if ($self->{location}) {return $self->{location}}
     else {return 0}
}
HideShow 11 lines of Pod
=head2 start()
 Title   : start()
 Usage   : $start_position = $primer->start($new_position);
 Function: Return the start position of this Primer.
           This is the leftmost base, regardless of whether it is a left or right primer.
 Returns : The start position of this primer or 0 if not set.
 Args    : If supplied will set a start position.
=cut
sub start {
     my ($self,$start) = @_;
     if ($start) {$self->{start_position} = $start}
     if ($self->{start_position}) {return $self->{start_position}}
     else {return 0}
}
HideShow 11 lines of Pod
=head2 end()
 Title   : end()
 Usage   : $end_position = $primer->end($new_position);
 Function: Return the end position of this primer.
           This is the rightmost base, regardless of whether it is a left or right primer.
 Returns : The end position of this primer.
 Args    : If supplied will set an end position.
=cut
sub end {
     my ($self,$end) = @_;
     if ($end) {$self->{end_position} = $end}
     if ($self->{end_position}) {return $self->{end_position}}
     else {return 0}
}
HideShow 10 lines of Pod
=head2 strand()
 Title   : strand()
 Usage   : $strand=$primer->strand()
 Function: Get or set the strand.
 Returns : The strand that the primer binds to.
 Args    :  If an argument is supplied will set the strand, otherwise will return it. Should be 1, 0 (not set), or -1
=cut
sub strand {
     my ($self, $strand) = @_;
     if ($strand) {
      unless ($strand == -1 || $strand == 0 ||$strand == 1) {$self->throw("Strand must be either 1, 0, or -1 not $strand")}
      $self->{strand}=$strand;
     }
     if ($self->{strand}) {return $self->{strand}}
     else {return 0}
}
HideShow 10 lines of Pod
=head2 display_id()
 Title   : display_id()
 Usage   : $id = $primer->display_id($new_id)
 Function: Returns the display ID for this Primer feature
 Returns : A scalar.
 Args    : If an argument is provided, the display_id of this primer is set to that value.
=cut
sub display_id {
     my ($self,$newid) = @_;
     if ($newid) {$self->seq()->display_id($newid)}
     return $self->seq()->display_id();
}
HideShow 18 lines of Pod
=head2 Tm()
  Title   : Tm()
  Usage   : $tm = $primer->Tm(-salt=>'0.05', -oligo=>'0.0000001')
  Function: Calculates and returns the Tm (melting temperature) of the primer
  Returns : A scalar containing the Tm.
  Args    : -salt set the Na+ concentration on which to base the calculation (default=0.05 molar).
          : -oligo set the oligo concentration on which to base the calculation (default=0.00000025 molar).
  Notes   : Calculation of Tm as per Allawi et. al Biochemistry 1997 36:10581-10594.  Also see
            documentation at http://biotools.idtdna.com/analyzer/ as they use this formula and
            have a couple nice help pages.  These Tm values will be about are about 0.5-3 degrees
            off from those of the idtdna web tool.  I don't know why.
            This was suggested by Barry Moore (thanks!). See the discussion on the bioperl-l
            with the subject "Bio::SeqFeature::Primer Calculating the PrimerTM"
=cut
sub Tm  {
     my ($self, %args) = @_;
     my $salt_conc = 0.05; #salt concentration (molar units)
     my $oligo_conc = 0.00000025; #oligo concentration (molar units)
     if ($args{'-salt'}) {$salt_conc = $args{'-salt'}} #accept object defined salt concentration
     if ($args{'-oligo'}) {$oligo_conc = $args{'-oligo'}} #accept object defined oligo concentration
     my $seqobj = $self->seq();
     my $length = $seqobj->length();
     my $sequence = uc $seqobj->seq();
     my @dinucleotides;
     my $enthalpy;
     my $entropy;
     #Break sequence string into an array of all possible dinucleotides
     while ($sequence =~ /(.)(?=(.))/g) {
         push @dinucleotides, $1.$2;
     }
     #Build a hash with the thermodynamic values
     my %thermo_values = ('AA' => {'enthalpy' => -7.9,
                                   'entropy'  => -22.2},
                          'AC' => {'enthalpy' => -8.4,
                                   'entropy'  => -22.4},
                          'AG' => {'enthalpy' => -7.8,
                                   'entropy'  => -21},
                          'AT' => {'enthalpy' => -7.2,
                                   'entropy'  => -20.4},
                          'CA' => {'enthalpy' => -8.5,
                                   'entropy'  => -22.7},
                          'CC' => {'enthalpy' => -8,
                                   'entropy'  => -19.9},
                          'CG' => {'enthalpy' => -10.6,
                                   'entropy'  => -27.2},
                          'CT' => {'enthalpy' => -7.8,
                                   'entropy'  => -21},
                          'GA' => {'enthalpy' => -8.2,
                                   'entropy'  => -22.2},
                          'GC' => {'enthalpy' => -9.8,
                                   'entropy'  => -24.4},
                          'GG' => {'enthalpy' => -8,
                                   'entropy'  => -19.9},
                          'GT' => {'enthalpy' => -8.4,
                                   'entropy'  => -22.4},
                          'TA' => {'enthalpy' => -7.2,
                                   'entropy'  => -21.3},
                          'TC' => {'enthalpy' => -8.2,
                                   'entropy'  => -22.2},
                          'TG' => {'enthalpy' => -8.5,
                                   'entropy'  => -22.7},
                          'TT' => {'enthalpy' => -7.9,
                                   'entropy'  => -22.2},
                          'A' =>  {'enthalpy' => 2.3,
                                   'entropy'  => 4.1},
                          'C' =>  {'enthalpy' => 0.1,
                                   'entropy'  => -2.8},
                          'G' =>  {'enthalpy' => 0.1,
                                   'entropy'  => -2.8},
                          'T' =>  {'enthalpy' => 2.3,
                                   'entropy'  => 4.1}
                         );
     #Loop through dinucleotides and calculate cumulative enthalpy and entropy values
     for (@dinucleotides) {
        $enthalpy += $thermo_values{$_}{enthalpy};
        $entropy += $thermo_values{$_}{entropy};
     }
     #Account for initiation parameters
     $enthalpy += $thermo_values{substr($sequence, 0, 1)}{enthalpy};
     $entropy += $thermo_values{substr($sequence, 0, 1)}{entropy};
     $enthalpy += $thermo_values{substr($sequence, -1, 1)}{enthalpy};
     $entropy += $thermo_values{substr($sequence, -1, 1)}{entropy};
     #Symmetry correction
     $entropy -= 1.4;
     my $r = 1.987; #molar gas constant
     my $tm = ($enthalpy * 1000 / ($entropy + ($r * log($oligo_conc))) - 273.15 + (12* (log($salt_conc)/log(10))));
     $self->{'Tm'}=$tm;
     return $tm;
 }
HideShow 31 lines of Pod
=head2 Tm_estimate
 Title   : Tm_estimate
 Usage   : $tm = $primer->Tm_estimate(-salt=>'0.05')
 Function: Calculates and returns the Tm (melting temperature) of the primer
 Returns : A scalar containing the Tm.
 Args    : -salt set the Na+ concentration on which to base the calculation.
 Notes   : This is an estimate of the Tm that is kept in for comparative reasons.
           You should probably use Tm instead!
           This Tm calculations are taken from the Primer3 docs: They are
           based on Bolton and McCarthy, PNAS 84:1390 (1962) 
           as presented in Sambrook, Fritsch and Maniatis,
           Molecular Cloning, p 11.46 (1989, CSHL Press).
           Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length
           where [Na+] is the molar sodium concentration, %GC is the
           %G+C of the sequence, and length is the length of the sequence.
           However.... I can never get this calculation to give me the same result
           as primer3 does. Don't ask why, I never figured it out. But I did 
           want to include a Tm calculation here becuase I use these modules for 
           other things besides reading primer3 output.
           The primer3 calculation is saved as 'PRIMER_LEFT_TM' or 'PRIMER_RIGHT_TM'
           and this calculation is saved as $primer->Tm so you can get both and
           average them!
=cut
sub Tm_estimate {
 # note I really think that this should be put into seqstats as it is more generic, but what the heck.
 my ($self, %args) = @_;
 my $salt=0.2;
 if ($args{'-salt'}) {$salt=$args{'-salt'}}
 my $seqobj=$self->seq();
 my $length=$seqobj->length();
 my $seqdata = Bio::Tools::SeqStats->count_monomers($seqobj);
 my $gc=$$seqdata{'G'} + $$seqdata{'C'};
 my $percent_gc=($gc/$length)*100;
 my $tm= 81.5+(16.6*(log($salt)/log(10)))+(0.41*$percent_gc) - (600/$length);
 # and now error check compared to primer3
 # note that this NEVER gives me the same values, so I am ignoring it
 # you can get these out separately anyway
# if ($self->{'PRIMER_LEFT_TM'}) {
#  unless ($self->{'PRIMER_LEFT_TM'} == $tm) {
#   $self->warn("Calculated $tm for Left primer but received ".$self->{'PRIMER_LEFT_TM'}." from primer3\n");
#  }
# }
# elsif ($self->{'PRIMER_RIGHT_TM'}) {
#  unless ($self->{'PRIMER_RIGHT_TM'} == $tm) {
#    $self->warn("Calculated $tm for Right primer but received ".$self->{'PRIMER_RIGHT_TM'}." from primer3\n");
#  }
# }
 $self->{'Tm'}=$tm;
 return $tm; 
} 
1;