# This is -*-Perl-*- code
## Bioperl Test Harness Script for Modules
##
# $Id: Perl.t,v 1.8.6.1 2006/10/16 17:08:15 sendu Exp $
# Before `make install' is performed this script should be runnable with
# `make test'. After `make install' it should work as `perl test.t'
use strict;
use vars qw($NUMTESTS $DEBUG $BIODBTESTS);
$DEBUG = $ENV{'BIOPERLDEBUG'} || 0;
my $error;
BEGIN { 
        # to handle systems with no installed Test module
        # we include the t dir (where a copy of Test.pm is located)
        # as a fallback
        eval { require Test; };
        $error = 0;
        if( $@ ) {
                use lib 't';
        }
        use Test;
        $NUMTESTS = 14;
        $BIODBTESTS = 5;
        plan tests => $NUMTESTS;
        eval { require IO::String };
        if( $@ ) {
                print STDERR "IO::String not installed. This means the Bio::DB::* modules are not usable. Skipping some tests.\n";
                for( 1..$BIODBTESTS ) {
                        skip("IO::String not installed. This means the Bio::DB::* modules are not usable. Skipping some tests",1);
                }
                $error = 1;
        }
}
END {
        # clean up after oneself
        unlink (  'Perltmp' );
        for ( $Test::ntest..$NUMTESTS ) {
                skip("Unable to run database access tests",1);
        }
}
use Bio::Perl;
use File::Spec;
## End of black magic.
##
## Insert additional test code below but remember to change
## the print "1..x\n" in the BEGIN block to reflect the
## total number of tests that will be run. 
my ($seq_object,$filename,@seq_object_array);
# will guess file format from extension
$filename = File::Spec->catfile(qw(t data cysprot1.fa));
ok ($seq_object = read_sequence($filename)); 
# forces genbank format
$filename = File::Spec->catfile(qw(t data AF165282.gb));
ok  ($seq_object = read_sequence($filename,'genbank')); 
# reads an array of sequences
$filename = File::Spec->catfile(qw(t data amino.fa));
ok (@seq_object_array = read_all_sequences($filename,'fasta'), 2); 
$filename = 'Perltmp';
ok write_sequence(">$filename",'genbank',$seq_object);
ok ($seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA","myname","AL12232"));
my $trans;
ok ($trans = translate($seq_object));
ok ($trans = translate("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA"));
ok ($trans = translate_as_string($seq_object));
ok ($trans = translate_as_string("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA"));
# we need to keep tests that depend on net connection at the end
unless ( $error ) {
    # swissprot
    eval {
        ok ($seq_object = get_sequence('swissprot',"ROA1_HUMAN"));
    };
    if ($@) {
        if($DEBUG) {
            warn "Warning: Couldn't connect to SWISS-PROT! Do you have network access?\n";
        }
        exit 0;
    }
    # embl
    eval {
        ok ($seq_object = get_sequence('embl',"BUM"));
    };
    if ($@) {
        if($DEBUG ) {
            warn "Warning: Couldn't connect to EMBL! Do you have network access?\n";
        }
        exit 0;
    }
    # genbank
    eval {
        ok ($seq_object = get_sequence('genbank',"AI129902"));
    };
    if ($@) {
        if($DEBUG) {
            warn "Warning: Couldn't connect to GenBank! Do you have network access?\n";
        }
        exit 0;
    }
    # refseq
    eval {
        ok ($seq_object = get_sequence('genbank',"NM_006732"));
    };
    if ($@) {
        if( $DEBUG ) {
            warn "Warning: Couldn't connect to RefSeq! Do you have network access?\n";
        }
        exit 0;
    }
        # genbank
    eval {
        ok ($seq_object = get_sequence('genpept',"AAC06201"));
    };
    if ($@) {
        if($DEBUG) {
            warn "Warning: Couldn't connect to GenPept! Do you have network access?\n";
        }
        exit 0;
    }
}