From Code to Community: Sponsoring The Perl and Raku Conference 2025 Learn more

ID M20132:(362)[c.+4G|A|T;c.+31C|A]; [E2|K|X;Q11|K]
Feature DNA; 1.1
Feature /label: point, transition
Feature /proof: computed
Feature /location: 4
Feature /upflank: gaagattcagccaagctcaaggatg
Feature /change: g|a
Feature /dnflank: aagtgcagttagggctgggaagggt
Feature /re_site: -BccI
Feature DNA; 1.2
Feature /label: point, transversion
Feature /proof: computed
Feature /location: 4
Feature /upflank: gaagattcagccaagctcaaggatg
Feature /change: g|t
Feature /dnflank: aagtgcagttagggctgggaagggt
Feature /re_site: -BccI
Feature RNA; 1.1
Feature /label: missense
Feature /proof: experimental
Feature /location: 4 (M20132::366)
Feature /upflank: gaagattcagccaagctcaaggatg
Feature /change: g|a
Feature /dnflank: aagtgcagttagggctgggaagggt
Feature /re_site: -BccI
Feature /codon_table: 1
Feature /codon: gaa|aaa; 1
Feature /region: coding
Feature RNA; 1.2
Feature /label: nonsense
Feature /proof: experimental
Feature /location: 4 (M20132::366)
Feature /upflank: gaagattcagccaagctcaaggatg
Feature /change: g|t
Feature /dnflank: aagtgcagttagggctgggaagggt
Feature /re_site: -BccI
Feature /codon_table: 1
Feature /codon: gaa|taa; 1
Feature /region: coding
Feature AA; 1.1
Feature /label: substitution, conservative
Feature /proof: computed
Feature /location: 2
Feature /change: E|K
Feature AA; 1.2
Feature /label: truncation
Feature /proof: computed
Feature /location: 2
Feature /change: E|*
Feature DNA; 2
Feature /label: point, transversion
Feature /proof: computed
Feature /location: 31
Feature /upflank: gaagattcagccaagctcaaggatg
Feature /change: c|a
Feature /dnflank: aagtgcagttagggctgggaagggt
Feature /re_site: -CviRI, -SfaNI
Feature RNA; 2
Feature /label: missense
Feature /proof: experimental
Feature /location: 31 (M20132::393)
Feature /upflank: gaagattcagccaagctcaaggatg
Feature /change: c|a
Feature /dnflank: aagtgcagttagggctgggaagggt
Feature /re_site: -CviRI, -SfaNI
Feature /codon_table: 1
Feature /codon: caa|aaa; 1
Feature /region: coding
Feature AA; 2
Feature /label: substitution, conservative
Feature /proof: computed
Feature /location: 11
Feature /change: Q|K
//