# -*-Perl-*-
## Bioperl Test Harness Script for Modules
## $Id: DNAMutation.t,v 1.7 2002/03/20 13:08:04 heikki Exp $
# Before `make install' is performed this script should be runnable with
# `make test'. After `make install' it should work as `perl test.t'
use strict;
BEGIN {
# to handle systems with no installed Test module
# we include the t dir (where a copy of Test.pm is located)
# as a fallback
eval { require Test; };
if( $@ ) {
use lib 't';
}
use Test;
plan tests => 36 }
ok(1);
## End of black magic.
##
## Insert additional test code below but remember to change
## the print "1..x\n" in the BEGIN block to reflect the
## total number of tests that will be run.
my($obj,$a1,$a2,$obj2);
$obj = Bio::Variation::DNAMutation -> new;
ok defined $obj;
$obj->start(3);
ok $obj->start, 3;
$obj->end(3);
ok $obj->end, 3;
$obj->length(2);
ok $obj->length, 2;
$obj->strand('1');
ok $obj->strand, '1';
ok $obj->primary_tag, 'Variation';
$obj->source_tag('source');
ok $obj->source_tag, 'source';
$obj->frame(2);
ok $obj->frame,2;
$obj->score(2);
ok $obj->score, 2;
if( $obj->can('dna_mut') ) {
#test gff string
$obj->dna_mut('dna_mut');
ok( $obj->dna_mut,'dna_mut');
}
$a1 = Bio::Variation::Allele->new(-seq => 'c');
$obj->allele_ori($a1);
ok $obj->allele_ori->seq, 'c';
$a2 = Bio::Variation::Allele->new('-seq' => 'g');
$obj->allele_mut($a2);
ok $obj->allele_mut->seq, 'g';
$obj->upStreamSeq('agcacctcccggcgccagtttgctg');
ok $obj->upStreamSeq, 'agcacctcccggcgccagtttgctg';
$obj->dnStreamSeq('tgctgcagcagcagcagcagcagca');
ok $obj->dnStreamSeq, 'tgctgcagcagcagcagcagcagca';
ok $obj->label, 'point, transversion' ;
$obj->status('proven');
ok $obj->status, 'proven';
$obj->proof('experimental');
ok $obj->proof, 'experimental';
ok $obj->restriction_changes, '-BbvI, +BstXI, -Fnu4HI, -TseI';
$obj->region('region');
ok $obj->region, 'region';
$obj->region_value('region_value');
ok $obj->region_value, 'region_value';
$obj->region_dist(-5);
ok $obj->region_dist, -5;
$obj->numbering('coding');
ok $obj->numbering, 'coding';
ok not $obj->CpG;
$obj->mut_number(2);
ok $obj->mut_number, 2;
ok defined ($obj2 = Bio::Variation::DNAMutation -> new
('-mut_number' => 2));
ok $obj2->mut_number, 2;
$obj->isMutation(1);
ok $obj->isMutation;
$obj->add_Allele($a1);
$obj->add_Allele($a2);
ok scalar ($obj->each_Allele), 2;
$obj = Bio::Variation::DNAMutation->new
('-start' => 23,
'-end' => 24,
'-length' => 2,
'-upStreamSeq' => 'gt',
'-dnStreamSeq' => 'at',
'-proof' => 'experimental',
'-isMutation' => 1,
'-mut_number' => 2
);
ok $obj->start(), 23;
ok $obj->end(), 24;
ok $obj->length(), 2;
ok $obj->upStreamSeq(), 'gt';
ok $obj->dnStreamSeq(), 'at';
ok $obj->proof(), 'experimental';
ok $obj->mut_number(), 2;
ok $obj->isMutation;