TAIR::Blast - A module to gather automated BLAST result from TAIR (http://www.arabidopsis.org/Blast/index.jsp)
Version 1.00
This module simply automatically! BLAST any type of sequences (nucleotide, protein) with using different type of algorithm (blastp, blastn, tblastx etc.) by using TAIR Blast engine.
#METHOD #1 for one sequence only use TAIR::Blast; my $TB = TAIR::Blast->new(); #START OF PARAMETERS FOR BLAST# my $query = "estExt_fgenesh4_pm.C_1450005"; my $query_seq = "ATGGGAGCTGTTGCTGCGATATGGTGGTTAACGGTGGTTGCTGCTGCATCTCGCCTTTCATTCCTGCACGCCT"; my $algorithm = "blastn"; #other set : blastp, blastx, tblastx,tblastn my $maxscore; #http://www.arabidopsis.org/help/helppages/BLAST_help.jsp#alignments (OPTIONAL #default=250) my $blast_target_set; #http://www.arabidopsis.org/help/helppages/BLAST_help.jsp#datasets (OPTIONAL #default for blastn, tblastx, tblastn is At_transcripts and for blastp and blastx is ATH1_pep. You can alternatively select from the list according to algorithm) #At_transcripts = TAIR10 Transcripts (-introns, +UTRs) (DNA) #ATH1_cds = TAIR10 CDS (-introns, -UTRs) (DNA) #ATH1_seq = TAIR10 Genes (+introns, +UTRs) (DNA) #ATH1_pep = TAIR10 Proteins (Protein) #ATH1_bacs_con = TAIR10 Whole Genome (BAC clones) (DNA) #At_upstream_500 = TAIR10 Loci Upstream Sequences -- 500 bp (DNA) #At_upstream_1000 = TAIR10 Loci Upstream Sequences -- 1000 bp (DNA) #At_upstream_3000 = TAIR10 Loci Upstream Sequences -- 3000 bp (DNA) #At_downstream_1000 = TAIR10 Loci Downstream Sequences -- 1000 bp (DNA) #At_downstream_3000 = TAIR10 Loci Downstream Sequences -- 3000 bp (DNA) #At_intergenic = TAIR10 Intergenic (DNA) #At_intron = TAIR10 Intron (DNA) #ATH1_5_UTR = TAIR10 5' UTRs (DNA) #ATH1_3_UTR = TAIR10 3' UTRs (DNA) #At_flanks_DNA = A. thaliana Insertion Flanks (DNA) #At_Uniprot_prot = A. thaliana UniProt (Protein) #At_GB_exp_prot = A. thaliana GB derived from mRNA (Protein) #At_GB_refseq_prot = A. thaliana GB refseq/tpa (Protein) #At_GB_all_prot = A. thaliana GB all (Protein) #At_GB_exp_tx_DNA = A. thaliana GB experimental cDNA/EST (DNA) #At_GB_refseq_tx_DNA = A. thaliana GB refseq/tpa cDNA (DNA) #At_GB_genomic_DNA = A. thaliana GB genomic (DNA) #gp_GB_exp_prot = Green plant GB derived from mRNA (Protein) #gp_GB_refseq_prot = Green plant GB refseq/tpa (Protein) #gp_GB_all_prot = Green plant GB all (Protein) #gp_GB_exp_tx_DNA = Green plant GB experimental cDNA/EST (DNA) #gp_GB_refseq_tx_DNA = Green plant GB refseq/tpa cDNA (DNA) #gp_GB_genomic_DNA = Green plant GB genomic (DNA) #END OF PARAMETERS FOR BLAST# my $verbose = 1; #default (0, no info); my $result = $TB->connect($query,$query_seq,$algorithm,$maxscore,$blast_target_set,$verbose); #you would like to have the output recorded! my $output_file = "output_file.txt"; $TB->write($output_file); #METHOD #2 for multiple sequences with the help of Bio::DB::Fasta use TAIR::Blast; use Bio::DB::Fasta; #You may use different but it is good for parsing your fasta file! my $TB = TAIR::Blast->new(); my $fasta_file = "seqs.fasta"; my $algorithm = "blastn"; #other set : blastp, blastx, tblastx,tblastn my $maxscore; #http://www.arabidopsis.org/help/helppages/BLAST_help.jsp#alignments (OPTIONAL #default=250) my $blast_target_set; my $verbose = 1; my $stream = Bio::DB::Fasta->new($fasta_file)->get_PrimarySeq_stream; while (my $query = $stream->next_seq) { my $query_seq = $query->seq; #OTHER PARAMETERS ARE SAME AS IN METHOD 2 my $result = $TB->connect($query,$query_seq,$algorithm,$maxscore,$blast_target_set,$verbose); } my $output_file = "output_file.txt"; $TB->write($output_file); ...
Object-oriented master-hash!
Blast parameters, do not mess with them unless you know what you are doing.
This subroutine handles output of the program, it writes the blast results into a specified file name.
Haktan Suren, << <hsuren at vt.edu> >>
Please report any bugs or feature requests to bug-tair-blast at rt.cpan.org, or through the web interface at http://rt.cpan.org/NoAuth/ReportBug.html?Queue=TAIR-Blast. I will be notified, and then you'll automatically be notified of progress on your bug as I make changes.
bug-tair-blast at rt.cpan.org
You can find documentation for this module with the perldoc command.
perldoc TAIR::Blast
You can also look for information at:
RT: CPAN's request tracker
http://rt.cpan.org/NoAuth/Bugs.html?Dist=TAIR-Blast
AnnoCPAN: Annotated CPAN documentation
http://annocpan.org/dist/TAIR-Blast
CPAN Ratings
http://cpanratings.perl.org/d/TAIR-Blast
Search CPAN
http://search.cpan.org/dist/TAIR-Blast/
Copyright 2011 Haktan Suren.
This program is free software; you can redistribute it and/or modify it under the terms of either: the GNU General Public License as published by the Free Software Foundation; or the Artistic License.
See http://dev.perl.org/licenses/ for more information.
To install TAIR::Blast, copy and paste the appropriate command in to your terminal.
cpanm
cpanm TAIR::Blast
CPAN shell
perl -MCPAN -e shell install TAIR::Blast
For more information on module installation, please visit the detailed CPAN module installation guide.