NAME

Bio::WebService::LANL::SequenceLocator - Locate sequences within HIV using LANL's web tool

SYNOPSIS

    use Bio::WebService::LANL::SequenceLocator;
    
    my $locator = Bio::WebService::LANL::SequenceLocator->new(
        agent_string => 'Your Organization - you@example.com',
    );
    my @sequences = $locator->find([
        "agcaatcagatggtcagccaaaattgccctatagtgcagaacatccaggggcaagtggtacatcaggccatatcacctagaactttaaatgca",
    ]);

See "EXAMPLE RESULTS" below.

DESCRIPTION

This library provides simple programmatic access to LANL's HIV sequence locator web tool and is also used to power a simple, JSON-based web API for the same tool (via Bio::WebService::LANL::SequenceLocator::Server).

Nearly all of the information output by LANL's sequence locator is parsed and provided by this library, though the results do vary slightly depending on the base type of the query sequence. Multiple query sequences can be located at the same time and results will be returned for all.

Results are extracted from both tab-delimited files provided by LANL as well as the HTML itself.

EXAMPLE RESULTS

    # Using @sequences from the SYNOPSIS above
    use JSON;
    print encode_json(\@sequences);
    
    __END__
    [
       {
          "query" : "sequence_1",
          "query_sequence" : "AGCAATCAGATGGTCAGCCAAAATTGCCCTATAGTGCAGAACATCCAGGGGCAAGTGGTACATCAGGCCATATCACCTAGAACTTTAAATGCA",
          "base_type" : "nucleotide",
          "reverse_complement" : "0",
          "alignment" : "\n Query AGCAATCAGA TGGTCAGCCA AAATTGCCCT ATAGTGCAGA ACATCCAGGG  50\n       ::::::::    ::::::::: ::::: :::: :::::::::: :::::::::: \n  HXB2 AGCAATCA-- -GGTCAGCCA AAATTACCCT ATAGTGCAGA ACATCCAGGG  1208\n\n Query GCAAGTGGTA CATCAGGCCA TATCACCTAG AACTTTAAAT GCA  93\n       :::: ::::: :::::::::: :::::::::: :::::::::: ::: \n  HXB2 GCAAATGGTA CATCAGGCCA TATCACCTAG AACTTTAAAT GCA  1251\n\n  ",
          "hxb2_sequence" : "AGCAATCA---GGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCA",
          "similarity_to_hxb2" : "94.6",
          "start" : "373",
          "end" : "462",
          "genome_start" : "1162",
          "genome_end" : "1251",
          "polyprotein" : "Gag",
          "region_names" : [
             "Gag",
             "p17",
             "p24"
          ],
          "regions" : [
             {
                "cds" : "Gag",
                "aa_from_protein_start" : [ "125", "154" ],
                "na_from_cds_start" : [ "373", "462" ],
                "na_from_hxb2_start" : [ "1162", "1251" ],
                "na_from_query_start" : [ "1", "93" ],
                "protein_translation" : "SNQMVSQNCPIVQNIQGQVVHQAISPRTLNA"
             },
             {
                "cds" : "p17",
                "aa_from_protein_start" : [ "125", "132" ],
                "na_from_cds_start" : [ "373", "396" ],
                "na_from_hxb2_start" : [ "1162", "1185" ],
                "na_from_query_start" : [ "1", "27" ],
                "protein_translation" : "SNQMVSQNC"
             },
             {
                "cds" : "p24",
                "aa_from_protein_start" : [ "1", "22" ],
                "na_from_cds_start" : [ "1", "66" ],
                "na_from_hxb2_start" : [ "1186", "1251" ],
                "na_from_query_start" : [ "28", "93" ],
                "protein_translation" : "PIVQNIQGQVVHQAISPRTLNA"
             }
          ]
       }
    ]

METHODS

new

Returns a new instance of this class. An optional parameter agent_string should be provided to identify yourself to LANL out of politeness. See the "SYNOPSIS" for an example.

find

Takes an array ref of sequence strings. Sequences may be in amino acids or nucleotides and mixed freely. Sequences should not be in FASTA format.

If sequence bases are not clearly nucleotides or clearly amino acids, LANL seems to default to nucleotides. This can be an issue for some sequences since the full alphabet for nucleotides overlaps with the alphabet for amino acids. To overcome this problem, you may specify base => 'nucleotide' or base => 'amino acid' after the array ref of sequences. This forces every sequence to be interpreted as nucleotides or amino acids, so you cannot mix base types in your sequences if you use this option. n, nuc, and nucleotides are accepted aliases for nucleotide. a, aa, amino, and amino acids are accepted aliases for amino acid.

Returns a list of hashrefs when called in list context, otherwise returns an arrayref of hashrefs.

See "EXAMPLE RESULTS" for the structure of the data returned.

AUTHOR

Thomas Sibley <trsibley@uw.edu>

COPYRIGHT

Copyright 2014 by the Mullins Lab, Department of Microbiology, University of Washington.

LICENSE

Licensed under the same terms as Perl 5 itself.